Rapid real - time pcr for cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and ASPirin for pci stent graft patients

The response to clopidogrel and ASPirin in patients is known to be highly variable as bioavailability is dependent upon the conversion of the prodrug into the pharmacologically active clopidogrel and ASPirin. Blood samples were collected from consenting patients after they were on the maintenance dose of anti-platelet therapy. The real-time PCR method was developed for the identification of the specific mutations in the CYP2C19 gene (CYP2C19 *2 and CYP2C19*3) and ITGB3 gene (PlA1/ A2). The real-time PCR method using SYBR green was validated against the Sanger’s sequencing method described previously and used to determine the frequency and type of mutations of postPCI patients. The results indicated that patients carrying any CYP2C19 loss-of-function alleles had a higher event rate (52.5%) of the study group: 10% homozygous and 35% heterozygous (CYP2C19 *2); 7.5% heterozygous carriers (CYP2C19*3).

Carriers of the Leu33Pro polymorphism of ITGB3 gene accounted for approximately 10% of the study population. In conclusion, a genotyping variant of CYP2C19 and ITGB3 provides an excellent opportunity for optimizing the anti-platelet regimen post-PCI

pdf 74 trang Bích Huyền 02/04/2025 6380 Free
Bạn đang xem 20 trang mẫu của tài liệu "Rapid real - time pcr for cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and ASPirin for pci stent graft patients", để tải tài liệu gốc về máy hãy click vào nút Download ở trên.

File đính kèm:

  • pdfrapid_real_time_pcr_for_cyp2c19_and_itgb3_gene_detection_to.pdf

Nội dung text: Rapid real - time pcr for cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and ASPirin for pci stent graft patients

  1. JOURNAL OF MEDICAL RESEARCH RAPID REAL-TIME PCR FOR CYP2C19 AND ITGB3 GENE DETECTION TO OPTIMIZE THE USE OF CLOPIDOGREL AND ASPIRIN FOR PCI STENT GRAFT PATIENTS Nguyen Thi Trang, Luong Thi Lan Anh , Vu To Giang , Do Duc Huy, Nguyen Thi Minh Ngoc, Department of Biomedical and Genetics, Hanoi Medical University, Hanoi, Vietnam The response to clopidogrel and aspirin in patients is known to be highly variable as bioavailability is dependent upon the conversion of the prodrug into the pharmacologically active clopidogrel and aspirin. Blood samples were collected from consenting patients after they were on the maintenance dose of anti-platelet therapy. The real-time PCR method was developed for the identification of the specific mutations in the CYP2C19 gene (CYP2C19 *2 and CYP2C19*3) and ITGB3 gene(PlA1/ A2). The real-time PCR method using SYBR green was validated against the Sanger’s sequencing method described previously and used to determine the frequency and type of mutations of postPCI patients. The results indicated that patients carrying any CYP2C19 loss-of-function alleles had a higher event rate (52.5%) of the study group: 10% homozygous and 35% heterozygous (CYP2C19 *2); 7.5% heterozygous carriers (CYP2C19*3). Carriers of the Leu33Pro polymorphism of ITGB3 gene accounted for approximately 10% of the study population. In conclusion, a genotyping variant of CYP2C19 and ITGB3 provides an excellent opportunity for optimizing the anti-platelet regimen post-PCI. Keywords: coronary artery disease, CYP2C19, clopidogrel, ITGB3, aspirin resistance I. INTRODUCTION Coronary artery disease (CAD) is the Dual antiplatelet therapy with aspirin most common type of heart disease. It is the and a P2Y12 receptor antagonist including leading cause of death in the world in both clopidogrel is the standard of care in men and women [1]. In Vietnam, coronary patients undergoing PCI and in patients artery disease has been increasing rapidly with acute coronary syndromes (ACS) in recent years. Percutaneous coronary because this regimen has markedly intervention (PCI) is one of the most decreased the rate of cardiovascular common medical procedures performed for events. However, the substantial variability treatment of CAD. in pharmacodynamics response, as well as the moderate antiplatelet efficacy of Corresponding author: Nguyen Thi Trang, Department clopidogrel and aspirin, has raised major of Biomedical and Genetics, Hanoi Medical University concerns. Many researches have focused Email: [email protected] on the impact of genetic polymorphisms Received: 03 June 2017 encoding transport systems or enzymes Accepted: 16 November 2017 involved in the absorption and metabolism JMR 111 E2 (2) - 2018 1
  2. JOURNAL OF MEDICAL RESEARCH of these drugs. An ESC Guidelines class commonly investigated being the PlA1/A2 II recommendation has been given for the SNP (Leu33Pro) [6]. Some studies have management of acute coronary syndromes suggested an association between the patients (2011) to perform genotyping in presence of the PlA2 allele and increased high-risk PCI patients if a change in the anti- platelet activity, as determined by platelet platelet therapy will ensue based on the test aggregation and/or fibrinogen binding [7 - results [2]. 10]. Loss-of-function polymorphisms in The Realtime - PCR method is an CYP2C19 are the strongest individual accurate way of defining polymorphism, variables affecting pharmacokinetics with the advantage of relatively simple, and antiplatelet response to clopidogrel. fast-paced techniques that have opened up CYP2C19 G681A (*2) and CYP2C19 new possibilities for applying this technique G636A (*3) alleles are associated with CYP as a routine test before indications of function reduction, impaired clopidogrel clopidogrel and aspirin therapy for PCI responsiveness and increased subsequent patients. The aim of this study was to post-PCI ischemic outcomes [3 - 5]. investigate the frequencies of CYP2C19 The GPllb/llla receptor is a key regulator G681A (*2; rs4244285), CYP2C19 G636A of platelet aggregation. Consequently, (*3; rs4986893) and PlA1/ PlA2 (T1565C, polymorphisms within the GPllb/llla rs5918) polymorphisms of CYP2C19 and receptor have been of great interest with ITGB3 gene in study subjects by Realtime regard to aspirin resistance, the most - PCR technique. II. MATERIALS AND METHODS 1. Sample collection: 40 patients undergoing PCI procedure with coronary artery disease were offered the genetic test by the treating cardiologist to identify CYP2C19 and ITGB3 genotype. All patients were treated with an aspirin (325 mg) and clopidogrel (600 mg) loading dose before the procedure. 2. Method: About 3 ml of venous blood were collected in a tube containing EDTA. Peripheral blood leucocytes were separated by centrifugation. DNA was extracted from peripheral blood with DNA Expression Kit (Lytech, Russia). Realtime - PCR technique was used to identify polymorphism of CYP2C19 gene (CYP2C19*2 , CYP2C19*3) and ITGB3 gene (PlA1 / PlA2). The primers used for PCR of each polymorphism are given in Table 1: 2 JMR 111 E2 (2) - 2018
  3. JOURNAL OF MEDICAL RESEARCH Table 1. FP - Forward primer, ASP - Allele specific primer, RP- Reverse primer. Gene Primer FP 5’ – CCCACTATCATTGATTATTTCTCG – 3’ CYP2C19*2 ASP 5’– CCCACTATCATTGATTATTTCTCA-3’ (G681A) RP 5’ – ACGCAAGCAGTCACATAACTA – 3’ FP 5’ – GGATTGTAAGCACCCCCAGG – 3’ CYP2C19*3 ASP 5 – GGATTGTAAGCACCCCCAGA – 3’ (G636A) RP 5’ – TCACCCCATGGCTGTCTAGG – 3’ Leu33Pro FP 5’ – GCTCCAATGTACGGGGTAAAC – 3’ (T1565C) ASP 5’ – GCTCCAATGTACGGGGTAAAT – 3’ RP 5’ – GGGGACTGACTTGAGTGACCT – 3’ Realtime - PCR technique was performed on CFX96 (BioRad, USA). The cycling programmer involved preliminary denaturation at 93°C for 1 min, followed by 35 cycles of denaturation at 93°C for 10 seconds, annealing at 64°C for 10 seconds, and elongation at 72°C for 20 seconds followed by a final elongation step at 72°C for 5 min. Using the DNA-express kit for DNA extraction and Realtime Techniques - Genomic PCR and mutation analysis are time-saving methods: saving an average of 45 minutes for DNA extraction and 90 minutes for gene polymorphism. This technique is therefore highly applicable in clinical practice to quickly and accurately identify patients' genotypes prior to the introduction of the regimen as well as the dose of clopidogrel and aspirin. Statistical analysis The continuous data were presented as mean and standard deviation (SD). The statistical analyses were conducted using SPSS (SPSS Statistics for Windows, Version 17.0. Chicago: SPSS Inc.) 3. Ethics All patients were duly informed of the benefit of such a test and were asked to sign an informed consent form before blood collection. Ethical clearance was obtained from the Hanoi Medical University Institutional Ethics Committee. III. RESULTS 1. Characteristics of the study population There were 40 patients enrolled in the study ranging in age from 39 to 79 years, the majority were men (85%). Patients with high risk factors for cardiovascular disease were relatively many, including hypertension (72.5%) and hypercholesterolemia (32.5%) (Table 2). JMR 111 E2 (2) - 2018 3
  4. JOURNAL OF MEDICAL RESEARCH Table 2. Characteristics of the study group Characteristics n % Gender Male 34 85 Female 6 15 Hypertension 29 72.5 Diabetes mellitus 9 22.5 Hypercholesterolemia 13 32.5 Stents ≥ 2 times 7 17.5 Mean SD Age(Year) 62.6 9.5 2. CYP2C19 and ITGB3 polymorphism detection rates using Realtime – PCR technique. Table 3 indicated that the rates of CYP2C19*2 and CYP2C19*3 polymorphisms in the study group were relatively large: 52.5% of patients carrying at least one CYP2C19 allelic variant reduced the function of clopidogrel metabolism. In addition, 10% of patients had ITGB3 polymorphism associated with aspirin resistance. Table 3. CYP2C19 and ITGB3 polymorphism detection rates using Realtime - PCR Gene Characteristic CYP2C19 ITGB3 CYP2C19 *2, *3 PlA1/ PlA2 Gender n % n % Male 16 47.1 3 8.8 Female 4 66.7 1 16.7 Total 21 52.5 4 10 3. Genotype frequencies of study subjects. Table 4 shows that the number of patients with CYP2C19*2 allele accounted for 45%, mainly heterozygous (35%), homozygotes (10%). 7.5% of patients with CYP2C19*3 allele, all of them are heterozygous. 10% of patients carry PlA2 alleles - all of them are heterozygous. 4 JMR 111 E2 (2) - 2018
  5. JOURNAL OF MEDICAL RESEARCH Table 4. Genotype frequencies of study subjects. Genotype frequency Allele frequency Wild Hetero - Homo- Gene Wild type allele Mutant allele type zygous zygous n % n % n % n Freq. n Freq. CYP2C19*2 22 55.0 14 35.0 4 10 681G 0.725 681A 0.275 (G681A) CYP2C19*3 37 92.5 3 7.5 0 0 636G 0.9625 636A 0.0375 (G636A) PlA1/PlA2 36 90.0 4 10.0 0 0 1565T 0.95 1565C 0.05 (T1565C) IV. DISCUSSION The combination of aspirin and coronary heart disease. clopidogrel is the mainstay anti - platelet Several polymorphisms of the CYP2C19 strategy for preventing ischemic events after gene have been identified and they produce PCI. However, many studies have shown an inactive enzyme. Two inactive genetic resistance to aspirin and clopidogrel, which variants (CYP2C19*2 and CYP2C19*3) reduces the effectiveness of treatment. account for more than 95% of cases of poor According to Boris T. et al. (2009), the rate metabolism of the relevant medications [14]. of no responsiveness to aspirin varied The genotypes were distributed as good from 5% to 60%, with clopidogrel 6% -25% or normal metabolizers (CYP2C19*1/*1; and both drugs 10.4% [11]. In Vietnam, also called extensive metabolizers in according Do Quang Huan (2013), in 174 literature), intermediate (*1/*2; *1/*3, patients with coronary artery disease *2/*17, and *3/*17), poor (*2/*2 and *3/*3), enrolled in the study, the prevalence of rapid (*1/*17), and ultra-rapid metabolizers nonresponse to aspirin and clopidogrel (*17/*17). were 21.3% and 26.4% [12]. According In our study, more than half of the study to Ibrahim O. (2013), aspirin resistance/ population carriers of at least one CYP2C19 non-responders in their study at acute loss-of-function allele (CYP2C19 * 2 or coronary syndrome patients accounted for CYP2C19 * 3). The results of our study were 4.69% while non-responders to clopidogrel similar to those found in Liu Mao’s study accounted for 21.9% [13]. Thus, studies on (2013): about 55% of Asians have one or factors related to clopidogrel and aspirin more loss-of-function allele of CYP2C19 resistance, particularly genetic factors, are [15]. Among them, the frequencies of essential in the prevention and treatment of heterozygous CYP2C19 G681A (*2) in our JMR 111 E2 (2) - 2018 5
  6. JOURNAL OF MEDICAL RESEARCH study was 35% (14 patients), the frequencies prevalence of mutations that would alter of heterozygous CYP2C19 G636A (*3) the normal function of the CYP2C19 gene was 7.5% (3 patients). Poor metabolizers, in metabolizer clopidogrel. Our study also with both alleles being mutated and hence found that the small rate of individuals unable to metabolize clopidogrel, formed with the PlA2 allele of SNP rs5918 of the 10% of the population (4 patients), all of ITGB3 gene reduces the response to them are homozygous CYP2C19 *2. Thus, aspirin. Variability or resistance to aspirin or the intermediate metabolizers and the poor clopidogrel has been demonstrated using metabolizers of clopidogrel are relatively various in vivo biomarkers and ex vivo large. As recommended by the American platelet function tests. Accumulating data Association for Clinical Pharmacology and suggested that patients with resistance are Clinical Pharmacy (ASCPT) in 2013 for the at high risk for ischemic events, including use of platelet antiplatelet drugs [16]: it is stent thrombosis. Thus, cardiologists have necessary to consider alternative treatment focused much attention on the adequacy of sor treatment strategies in patients identified antiplatelet regimens. as CYP2C19 intermediate metabolizers and Study limitations: First and foremost, poor metabolizers. Therefore, identifying among the limitations of the present study the genotype of an individual before taking is its small sample size and absence it a clopidogrel is necessary to achieve its control group, although we tried to overcome optimal anti-platelet activity. this shortcoming by matching the cases. We In addition, our study identified that calculated our sample size based on the 4 patients (10% of study population) frequency of the CYP2C19*2 alleles in the were PLA1/A2 heterozygotes. No PLA2 Vietnam population. However, our achieved homozygotes were found in the study power was markedly reduced due to the group. No patients carry the PlA2 / PlA2 low frequency of the non-functional allele homozygous genotype. According to a in our study population. Moreover, while study by Sperr W. R. et al. (1998), in central we focused on CYP2C19*2, CYP2C19*3 Europeans, the PlA1/A2 allele is present in and PlA2 as the most important alleles 20-30 % of people and the PlA2/A2 allele responsible for the resistance to clopidogrel is present in 1-3 % of people [8]. It has and aspirin therapy, we did not study been shown that platelets containing PlA1/ the prevalence of other non-functional A2 or PlA2/A2 alleles are more reactive CYP2C19 alleles. Further cohort studies than homozygous PlA1/A1 platelets with with larger samples and on different enhanced thrombin formation and a lower ethnicities in the Vietnam population are threshold for activation, granule release, required to determine the effects of the and fibrinogen binding, and therefore will CYP2C19 and ITGB3 polymorphism on have a variable response to the antiplatelet the prognosis of CAD patients who have effects of aspirin [9; 10]. undergone PCI and are receiving dual anti- Results from our study indicate high platelet therapy. 6 JMR 111 E2 (2) - 2018
  7. JOURNAL OF MEDICAL RESEARCH V. CONCLUSION for themanagement of acute coronary In our study, carriers of at least one syndromes in patients presenting without CYP2C19 loss-of-function allele (CYP2C19 persistent ST-segment elevation: The task * 2 or CYP2C19 * 3) approximately 52,5% of force for the management of ACS (acute the study population and 10% of the study coronary syndromes) in patients presenting population were PLA1/A2 heterozygotes of without persistent ST-segment elevation of ITGB3 gene. Therefore, the prevalence of the ESC (European Society of Cardiology), antiplatelet therapy nonresponse is higher Eur. Heart J. 32 (23): 2999 - 3054. in patients undergoing PCI. The Realtime - 3. Brant J.T., Close S.L, Iturria S.J. PCR technique is a fast, accurate and cost- et al. (2007). Common polymorphysm effective way to identify polymorphisms of of CYP2C19 and CYP2C9 affect the CYP2C19 gene and ITGB3 gene, that are phamacokinetic and pharmacodynamic suitable for Vietnamese conditions, and is respone to clopidogrel but not prasugrel. J clinically relevant. Using this method, the Thromb Heamost. 5: 2429 - 2436. common mutations that cause changes in 4. Mega J. L., Close S. L., Wiviott the bioavailability of clopidogrel and aspirin S. D., et al. (2009). Cytochrome p-450 may be reliably identified and the medication polymorphisms and response to clopidogrel. and dosage adjusted accordingly. Thus, this N Engl J Med, 360(4), 354 - 362. technique could be used as a routine test 5. Collet J. P., Hulot J. S., Pena before treatment of dual – platelet for PCI A., et al. (2009). Cytochrome P450 2C19 patients. polymorphism in young patients treated with clopidogrel after myocardial infarction: Acknowledgments a cohort study. Lancet, 373(9660), 309 - The authors would like to take this 317. opportunity to extend our sincere thanks to 6. Newman P. J., Derbes R. S., Center of Genetics Couseling for providing Aster R. H. (1989). The human platelet financial support for the study. We also are alloantigens, Pl(A1) and Pl(A2), are grateful for National Cardiovascular Institute associated with a leucine(33)/proline(33) for supporting us in identifying CYP2C19 amino acid polymorphism in membrane and ITGB3 mutations. glycoprotein IIIa, and are distinguishable by DNA typing. J. Clin. Invest. 83: 1778 - 1781. REFERENCES 7. Sirotkina OV, Khaspekova SG, 1. Shanthi Mendis, Pekka Puska, Zabotina AM, Shimanova YV, Mazurov Bo Norrving, (2011). Global Atlas on AV. (2007). Effects of platelet glycoprotein cardiovascular disease prevention and IIb-IIIa number and glycoprotein IIIa control. World Stroke Organization, 3 - 9. Leu33Pro polymorphism on platelet 2. C.W. Hamm, J.P. Bassand, S. aggregation and sensitivity to glycoprotein Agewall et al. (2011). ESC guidelines IIb-IIIa antagonists. Platelets. 18: 506 – 14. JMR 111 E2 (2) - 2018 7
  8. JOURNAL OF MEDICAL RESEARCH 8. Sperr W. R., Huber K., Roden M. Tạp chí Y học thực hành (878), số 8/2013, et al (1998). Inherited platelet glycoprotein 9 - 13. polymorphisms and a risk for coronary 13. Ibrahim O, Oteh M, A Syukur heart disease in young central Europeans. A et al (2013). Evaluation of Aspirin and Thromb Res. 90: 117 - 123. Clopidogrel resistance in patients with Acute 9. Undas A., Brummel K., Musial J. Coronary Syndrome by using Adenosine et al (2001). Pl(A2) polymorphism of beta- Diposphate Test and Aspirin Test. Pak J 3 integrins is associated with enhanced Med Sci, 29(1): 97 – 102. thrombin generation and impaired 14. Yuanyuan Dong, Huasheng Xiao, antithrombotic action of aspirin at the site of Qi Wang et al (2015). Analysis of genetic microvascular injury. Circulation. 104: 2666 variations in CYP2C9, CYP2C19, CYP2D6 - 2672. and CYP3A5 genes using oligonucleotide 10. Michelson A. D., Furman M.I., microarray. Int J Clin Exp Med 8(10): 18917 Goldschmidt-Clermont P. et al (2000). – 18926. Platelet GP. IIIa- PlA polymorphisms 15. Liu Mao et al (2013). Cytochrome display different sensitivities to agonists. CYP2C19 polymorphism and risk of Circulation. 101: 1013 - 1018. adverse clinical events in clopidogrel- 11. Boris T. I., Mareike Sausemuth treated patients: A meta-analysis based on H. I., Evangelos G. et al (2009). Dual 23035 subjects. Archives of Cardiovascular Antiplatelet Drug Resistance Is a Risk Disease. 106: 517 - 527. Factor for Cardiovascular Events after 16. Scott S. A., Sangkuhl K., Stein C. Percutaneous Coronary Intervention. M. et al (2013). Clinical Pharmacogenetics Clinical Chemistry. 55: 1171 - 1176 Implementation Consortium guidelines 12. Đỗ Quang Huân, Hồ Tấn Thịnh for CYP2C19 genotype and clopidogrel (2013). Tỷ lệ không đáp ứng với điều trị therapy: 2013 update. Clin Pharmacol Ther. thuốc chống kết tập tiểu cầu trên bệnh nhân 94(3), 317 - 323. được can thiệp động mạch vành qua da. 8 JMR 111 E2 (2) - 2018
  9. JOURNAL OF MEDICAL RESEARCH STUDY ON THE HYPOGLYCEMIC ACTION OF CF2 IN INDUCED TYPE 2-LIKE DIABETIC MICE MODEL Ho My Dung¹, Vu Thi Ngoc Thanh¹, Pham Thi Van Anh¹, Nguyen Thi Thanh Ha¹, Nguyen Thi Minh Hang² ¹Hanoi Medical University ²Institute of Marine Biochemistry - Vietnam Academy of Science and Technology To investigate the hypoglycemic action of CF2 in a type 2-like diabetic mice model induced by high fat diet (HFD) combined with streptozotocin (STZ) injection. Method: Model: mice were fed with HFD for 8 weeks, then injected with a dose of STZ (100 mg/kg body weight, intraperitoneal injection). Animal used: Swiss male mice. Drugs: type 2-like diabetic mice with HFD and STZ treated with either gliclazide 80 mg/kg body weight, CF2 2 m/kg or CF2 4 mg/kg body weight daily by oral route of ad- ministration during 14 days. Result: CF2 has blood glucose-lowering effect in type 2-like diabetic mice for 14 days treatment at doses of 2 mg/kg and 4mg/kg daily (p < 0.05). The blood glucose- lowering effect of CF2 at dose of 2 mg/kg daily is similar to gliclazide 80 mg/kg daily. CF2 at dose of 4mg/kg is more effective than that of 2 mg/kg and gliclazide 80 mg/kg in reducing blood glucose level. Con- clusion: CF2 has effect on lowering blood glucose level at doses of 2 mg/kg and 4 mg/kg daily for 14 days in type 2-like diabetic mice, induced by HFD and STZ 100 mg/kg intraperitoneal injection. Keywords: CF2, Callisia fragrans, ecdysteroid, type 2-like diabetic mice, STZ, HFD, blood glucose I. INTRODUCTION The prevalence of diabetes mellitus is predicted to rise to 642 million by 2040 [2]. increasing at an alarming rate globally. Ac- The health consequences of diabetes can cording to a World Health Organization re- overwhelm the health care systems due to port an estimated 422 million adults globally the severity of the long term complications were living with diabetes in 2014, compared of diabetes [1]. Several oral hypoglycemic to 108 million in 1980 [1]. The number of agent are available to lower blood glucose people with diabetes aged 20 - 79 years was levels in diabetics. However, their adminis- tration may cause side effects in patients [3; Corresponding author: Ho My Dung, Hanoi Medical 4]. Therefore, there is on urgent need to find University. new prevention strategies and treatments Email: [email protected] for diabetes. Recently, many plant-based Received: 15 June 2017 natural products that contain certain phy- Accepted: 16 November 2017 tochemicals are being investigated anti-di- JMR 111 E2 (2) - 2018 9
  10. JOURNAL OF MEDICAL RESEARCH abetic potential for their [5]. Using an herbal of age, and weighing between 23 - 27 remedy as an alternative therapy for diabe- grams, were used for this study. The mice tes treatment would reduce individuals de- were obtained from National Institute of Hy- pendence on synthetic oral hypoglycemic giene and Epidemiology, Viet Nam. The ex- agents [6]. The plant kingdom offers a wide perimental animals were caged individually field of possible effective oral hypoglycemic and acclimatised to laboratory conditions agents. for 2 weeks prior to the experiment. The Basket Plant (whose scientific name study was carried out at the Pharmaceutical is Callisia fragrans) has been used as a tra- Department of Hanoi Medical University. ditional therapy for pain, fever, digestive Machines and Chemicals disorders, heart diseases, diabetes, can- - Streptozotocin 1 g (Sigma-Aldrich, Sin- cers and many other airments [7; 8]. CF2 gapore), Buffer solution Citrate pH 4.5 powder is extracted from the leaves, stems - Diamicron (gliclazide) tablets 30 mg and shoots of Basket Plant. CF2 powder (Servier ,France). contains the active component ecdysteroid - Blood glucose monitoring system On which can be used in treating diabetes; Call EZII (ACON Biotech, USA) preventing inflammation and osteomalacia; - Animal blood counter Vet Exigo (Bonle protecting the nervous system; and improv- Medical AB, Sweden) ing the immune system [9; 10]. However, - Chemistry analyzer Erba and Test adequate characterization of CF2 effect is strips: blood triglyceride, HDL-C, cholester- yet to be done and no study has been per- ol (Transasia, India). formed using a type 2 diabetes model. The 2. Method objective of this study was to evaluate the The study was divided into two stages hypoglycemic action of CF2 in a model of [5]: induced type 2-like diabetic mice. Type-2 * The first stage: like diabetes was individual by high fat diet Before ending the study, all mice base- (HFD) combined with streptozotocin (STZ) line fasting glucose levels checked from pe- injection. ripheral blood samples. II. MATERIALS AND METHODS + Group 1: Control condition (n = 10) mice were randomized to one of two group: 1. Materials Normal fat diet regime (NFD) for 8 weeks. Experimental Medicine + Group 2: Diabetic condition (n = 70): CF2 powder extracted from leaves, High fat diet regime (HFD) in 8 weeks fol- stems and shoots of Basket Plant was sup- lowing Fabiola and Srinivasan method with plied by Institute of Marine Biochemistry, 43% saturated fat combined siro fructose Viet Nam. 55% [6]. Experimental Animals After 8 weeks, the fasting glucose level Swiss male white mice, from 6 - 8 weeks in all mice was checked. Mice in group 2 10 JMR 111 E2 (2) - 2018