Effects of umbilical cord exctracts on proliferation and gene expression of cultured human skin fibroblast

Wrinkles are consequences of skin aging. This process is characterized with collagen breakdown and shortage in skin structure. This study tested the effects of newborn umbilical cord extracts on the proliferation and synthesis of collagen type 1, fibronectin and metalloproteinase 1 (MMP-1) of human skin fibroblast. 25 formulas made of 4 types of extracts included: Extracellular extract of cord tissue; intracellular extract of cord cells; mixtures of these two extracts; intracellular extract of umbilical cord stem cells, were supplemented to culture media of human fibroblast. Cell proliferation was evaluated by MTT assay; gene expression was analyzed by Real-time RT-PCR technique. The results showed that supplementation of 7.5% of formula 3-5 containing a combination of both extra- And intra-cellular extracts of umbilical cord led to the highest cell proliferation and also stimulated the expression of collagen type 1 while inhibited the expression of MMP-1 on fibroblast.

These data suggested that umbilical cord extract would be a potential source of material for wrinkle reduction skin care product

pdf 7 trang Bích Huyền 04/04/2025 3860 Free
Bạn đang xem tài liệu "Effects of umbilical cord exctracts on proliferation and gene expression of cultured human skin fibroblast", để tải tài liệu gốc về máy hãy click vào nút Download ở trên.

File đính kèm:

  • pdfeffects_of_umbilical_cord_exctracts_on_proliferation_and_gen.pdf

Nội dung text: Effects of umbilical cord exctracts on proliferation and gene expression of cultured human skin fibroblast

  1. Journal of military pharmaco-medicine 7-2013 EFFECTS OF UMBILICAL CORD EXCTRACTS ON PROLIFERATION AND GENE EXPRESSION OF CULTURED HUMAN SKIN fIBROBLAST Pham Van Phuc*; Dang Thi Tung Loan*; Phan Kim Ngoc* Dinh Thanh Uyen**; Le Van Dong*** summary Wrinkles are consequences of skin aging. This process is characterized with collagen breakdown and shortage in skin structure. This study tested the effects of newborn umbilical cord extracts on the proliferation and synthesis of collagen type 1, fibronectin and metalloproteinase 1 (MMP-1) of human skin fibroblast. 25 formulas made of 4 types of extracts included: extracellular extract of cord tissue; intracellular extract of cord cells; mixtures of these two extracts; intracellular extract of umbilical cord stem cells, were supplemented to culture media of human fibroblast. Cell proliferation was evaluated by MTT assay; gene expression was analyzed by Real-time RT-PCR technique. The results showed that supplementation of 7.5% of formula 3-5 containing a combination of both extra- and intra-cellular extracts of umbilical cord led to the highest cell proliferation and also stimulated the expression of collagen type 1 while inhibited the expression of MMP-1 on fibroblast. These data suggested that umbilical cord extract would be a potential source of material for wrinkle reduction skin care product. * Key words: Skin aging; Wrinkle; Stem cel; Umbilical cord extract. INTRODUCTION Aging is the issue that is getting more and more attentions because of its social impacts. Skin aging is known to be caused mainly by exposure to light since then it is being referred as photo-aging, in which sunlight UV is main cause. UV ray activates signal transductions via protein kinases in cells located through dermis leading to the over expression of genes related to proteolysis of proteins in extracellular matrix such as metalloproteinase (MMP) 1 (collagenase), MMP-3 (stromelysis 1), and MMP-9 (gelatinase) [2, 5]. MMP-1 cuts collagen type I, III of skin tertiary structures then collagen continue to be digested by MMP-3 and MMP-9 [10]. Hence, once being induced by UV, MMP will break down collagen causing skin structure damage. If lack of factor to fix these damages, collagen damage caused by MMP will accumulate time to time and contribute to the human skin aging. Apart from collagen lysis, UV light also inhibits the synthesis of collagen type I and III [3]. Collagen breakout and less collagen synthesis are two directions leading to severe loses of collagen component in skin, causing changes in extracellular matrix, ultimately create wrinkles at the collagen lysis places. It is the main and most important of skin aging. Since then, skin anti-aging treatment needs to control the collagen lysis process, or inhibit the production of MMP in general and MMP-1 in particular and also stimulate the synthesis of new collagen. Stem cell extract and stem cell secreted factors and other factors that act on skin cells are considered to be able to do so that lead to skin anti-aging. Stem cells from various sources have demonstrated that they secrete numerous cytokines such as vascular endothelial growth factor (VEGF), transforming growth factor (TGF) and some proteins such as collagen, fibronectin, elastin etc. [9]. These proteins are mainly responsible for skin plasticity. Newborn umbilical cord is known to contain various types of stem cells, stem cell derived factors and essential factors for stem cells packed in different parts of the cord such as Wharton’s jelly, blood vessel and cord lining membrane. Since then, this research aimed: To test the effect of different extracellular and intracellular 1
  2. Journal of military pharmaco-medicine 7-2013 extracts of umbilical cord tissue and cells on the proliferation of human fibroblast and the synthesis of skin essential proteins such as collagen type I, fibronectin and MMP-1. Material and Methods 1. Isolation and culture of human skin fibroblast. Human skin fibroblasts of adult donors were isolated and cultured followed the standard procedures that was optimized previously in our lab as selection tissue culture o protocols with DMEM/F12 media supplemented with 10% FBS at 37 C, 5% CO2. The culture medium was replaced every four days. Subculture was done once the cell reached 70-80% confluence. After three subculture cyrcles, fibroblast was harvested and characterized by morphology evaluation and the expression of CD90 analyzed by flowcytometry by which more than 90% of cell population are positive with CD90. This cell population was then used for the whole experiments. 2. Umbilical cord stem cell sorting. Umbilical cord tissues were process mechanically to cell suspension. Stem cells were sorted by fluorescence activated cell sorting (FACS) method on FACSJazz system (BD Bioscience, USA). Each stem cell type was sorted as it stained with antibody to a specific marker: CD90 for mesenchymal stem cell; CD117 for epithelial stem cell; CD113 for vascular endothelial stem cell. 3. Preparation of cord cell and tissue extracts. * Umbilical cord collection and storage: 130 newborn umbilical cords samples that voluntarily donated by biological mothers were collected for research purpose. Mothers and the cords were selected following a strictly screening tests followed NetCord standards and had negative results to all HIV, HBV, HCV, CMV as described in our previous paper [1]. After collection in hospitals and transferred to the lab, each cord was taken a portion with the length ranging from 18 to 22 cm. The cords were then stored at -800C till further usage. * Preparation of extracellular extract: Frozen cords were defrosted in the 37oC water bath then washed with physiological saline; sliced, add buffer (saline supplemented with protease inhibitor, Sigma-Aldrich, USA) to protect protein from hydrolysis during the preparation process. The mixture was milled thoroughly then centrifuged at 3,000 rpm for 20 minutes at 4oC. The supernatant (namely as cord tissue extract or extracellular extract) was then serially diluted to different concentrations and kept at -80oC till the next usage. *. Preparation of cellular extract: The pellet obtained from above was quickly frozen with liquid nitrogen and defrosted with warm buffer (saline supplemented with protease inhibitor) then centrifuged at 3,000 rpm for 20 minutes at 4oC. The supernatant obtained after this step (namely as cord cellular extract or intracellular extract) was then serially diluted to different concentrations and kept at -80oC till the next usage. The cord tissue extract and cord cellular extract were mixed together in different ratio to form various formulas for further activity testing. * Preparation of stem cell extract: Stem cell cellular extract was also prepared as described above. * Cord extracts combinations: 5 main preparations were formulated: cord tissue extract, total cord cellular extract, cord stem cell extract, mixture of cord tissue and cord cellular extracts, control (physiological 2
  3. Journal of military pharmaco-medicine 7-2013 saline). Each preparation was diluted into five different concentrations and form 25 testing formulas coded as followed: Cord tissue extract: solution 1-1; 1-2; 1-3; 1-4; 1-5; Cord cellular extract: solution 2-1; 2-2; 2-3; 2-4; 2-5; Mixture of cord tissue and cord cellular extracts: solution 3-1; 3-2; 3-3; 3-4; 3-5; Cord stem cell extract: solution 4-1; 4-2; 4-3; 4-4; 4-5; Control: solution 5-1; 5-2; 5-3; 5-4; 5-5. 4. Cell proliferation assessment by MTT assay. The cell proliferation was evaluated following the instruction of manufacturer (Cell proliferating kit, GeneWorld, Hochiminh City, Vietnam) as followed: Take the 96 well cell culture plates out of the incubator and move to the clean cell culture area, add sterile MTT equal to 10% of final volume, put the 96 well cell culture plates back into the incubator for another 3 - 4 hours; after the incubation, take the plates out of the incubator and dissolved the MTT formazan crystals by adding equal volume of solvent. The absorbent was measured within 1 hour after adding the solvent with a spectrometer (Multimode Reader DTX880, Beckman-Coulter, USA) 570 nm (measure wavelength) and 690 nm (referent wavelength). 5. Realtime RT-PCR analysis. Total RNA was extracted as described in our previous study [7]. Genetic markers were analyzed are Collagen type I, Fibronectin and MMP-1. The Real-time RT-PCR analysis was perform on Eppendorf gradient S thermal Cycler system (Eppendorf-AG, Hamburg, Germany) with the primers are listed in table 1. Table 1: Details of primers used in this research. (5’-3’) . Collagen type I NM_000088.3 F: CGGAGGAAACTTTGCTCCCC [6] R: CCCTTAGCACCAGTGTCTCC Fibronectin NM_212482.1 F: TGAAGAGGGGCACATGCTGA R: GTGGGAGTTGGGCTGACTCG Matrixmetalloproteinase YP_003494989.1 F:AAAATCCTGTCCAGCCCATCG (MMP)-1 R:TTCTGTCCCTGAACAGCCCAGT 6. Data analysis. All tests were repeated three times. Value p ≤ 0.05 is considered as statistical significant. Data was analyzed by Statgraphics software 7.0 (Statgraphics Graphics System, Warrenton, VA). Results and Discussion 1. Effects of different extraction formulas on the proliferation of fibroblast. In this research, we had prepared 25 formulas for screening with fibroblast by supplement 10% of each formula to the cell culture media. MTT assay was utilized to evaluate the cell proliferation after 0, 2, 4, 6, 8 and 10 days and data are shown in figure 1. 3
  4. Journal of military pharmaco-medicine 7-2013 Figure 1: Proliferation rates of fibroblasts cultured in media supplemented with 25 different formulas after 0, 2, 4, 6, 8 and 10 days (from left to right). The increase of activity and proliferation of fibroblast help skin to keep its normal structure. Decrease in fibroblast proliferation and production of essential proteins of skin structure, especially collagen, is one of the causes leading to skin structure loses and wrinkle formation. Skin fibroblast proliferating stimulation is one important characteristics on skin rejuvenating and anti-wrinkle product. Data from figure 1 show that, generally in all formulas, fibroblast proliferates when they are being cultured. Among them, formula 3-5 shows strongest proliferation activity. At day 0, 2, 4 and 6, the amount of cells proliferated equally to other formulas; however, at day 8 and 10, the proliferation increased significantly in comparison to other formulas. This data indicate that, among 25 formulas tested, formula 3-5 contain essential elements necessary for fibroblast growth. In fact, formula 3-5 contain 4
  5. Journal of military pharmaco-medicine 7-2013 both extracellular and cellular extracts of umbilical cord tissues; among them proteins such as collagen, hyaluronic acid, stem cell derived growth factors etc. that stimulate fibroblast to growth better. The fact that formula 3-5 give the best effect also reflecting that fibroblast proliferation requires balanced proteins from both extracellular and cellular origins. In the other word, total extract from whole umbilical cord tissue give good effects on fibroblast. Others extracts - either from extracellular origin (solution 1-) or intracellular origin (solution 2- ) did not show clear stimulation effects during the culturing period tested. Proteins from extracellular and intracellular origins seem to work complementarily to each others. 2. Effects of concentrations of formula 3-5 on fibroblast proliferation. As the contents and preparation of formula 3-5 is rather expensive if adding too much to the final skin care product, we decided not to supplement more than 10% volume of the final product. As such, in this study, we test the effects f supplementing formula 3-5 at concentration of 2.5%, 5%, 7.5% and 10% volume of culture media. Data presented in figure 2 shows the different supplement concentrations giving different effects on fibroblast proliferation. In general, very little difference seen between 7.5% and 10% but significantly differences was seen between 10% and other concentrations. Since then we selected supplementation of 7.5% of formula 3-5 for the next experiments. Figure 2: Fibroblast proliferation after supplemented with 3-5 formula at different ratios after 0, 2, 4, 6, 8 and 12 days. 3. Effects on the expression of genes related to formation of wrinkle. Another important effect of anti-wrinkle product is stimulating fibroblast to produce factors necessary for skin restructuring and inhibit the production of products leading to break down of extracellular matrix. Consequently, in order to produce a anti-wrinkle product, formula 3-5 supplementation at 7.5% was selected for testing the effect on expression of genes related to skin restructure, especially wrinkle treatment. In this study, we assessed the expression of 3 genes namely collagen I, fibronectin and MMP-1. The RT-PCRs were compared between control (without formula 3-5) and test group supplemented with formula 3-5 at 7.5% and presented in figure 3. The results show that different expressions of the three tested genes were seen among tested and control subjects. In the tested group, stronger expression of collagen I was seen in comparison to control group; however, this is not significant difference. The expression of fibronectin is almost no change while the expression of MMP-1 strongly decreased (p > 0.5) in the tested group in comparison to control group. 5
  6. Journal of military pharmaco-medicine 7-2013 Figure 3: Changes in expression of some genes related to wrinkles in fibroblasts before and after treatment with formula 3-5 in vitro. One of the reasons leading to formation of wrinkle is the activity of MMPs (matrix metalloproteinase). MMP hydrolyses structural proteins in skin such as collagen, laminin, fibronectin and elastin. In order to keep skin structure balance, MMP-1 activity is regulated by proteins and MMP inhibitors called TIMP (tissue inhibitor of metalloproteinase). As skin aged, the imbalance between MMP-1 and TIMP make skin lose its structure and formation of wrinkle [4, 8]. Gaining back the regulation of MMP-1 activity or inhibit the expression of this gene is a key point in anti-wrinkle treatment. The above presented results show that the expression of MMP-1 strongly decreased as supplemented 7.5% of formula 3-5 to the fibroblast culture medium indicating that formula 3-5 inhibits MMP-1 expression. Since then, formula 3-5 is potentially be an anti wrinkle treatment in vivo. Conclusion This in vitro research demonstrates that the umbilical cord extracts have some effects on human fibroblast. Especially, formula 3-5 which is mixture of cord tissue and cellular extracts, shown strongest stimulation effect at 7.5%. At this concentration, fibroblast not only strongly proliferated but also decreased the expression of gene related to wrinkle formation such as MMP-1 and increased the expression of collagen I. These data show that umbilical cord extracts can be used for development of anti wrinkle skin care product. Acknowledgment This research was partially financially supported by research project “Development and evaluation the effects of beauty product from umbilical cord stem cell” Code: 188-2010 sponsored by Department of Science and Technology of Hochiminh City. References 1. Phạm Thúy Trinh, Lê Văn Đông và CS. Nghiên cứu phân lập tế bào gốc trung mô từ màng dây rốn trẻ sơ sinh. Tạp chí Thông tin Y dược. Số Chuyên đề Miễn dịch học. 2010, tr1-6. 2. Angel P, Szabowski A, Schorpp-Kistner M . Function and regulation of AP-1 subunits in skin physiology and pathology. Oncogene. 2001, 20, pp.2413-2423. 3. Fisher GJ, Datta S, Wang ZQ et al. c-Jun-dependent inhibition of cutaneous procollagen transcription following ultraviolet irradiation is reversed by all-trans retinoic acid. J Clin Invest. 2000, 10, pp.6663-6670. 4. Hornebeck W. Down-regulation of tissue inhibitor of matrix metalloprotease-1 (TIMP-1) in aged human skin contributes to matrix degradation and impaired cell growth and survival. Pathol Biol (Paris). 2003, 51 (10), pp.569-573. 5. Karin M, Liu Z-G, Zandi E. AP-1 function and regulation. Curr Opin Cell Biol. 1997, pp.9240-9246. 6
  7. Journal of military pharmaco-medicine 7-2013 6. Kim WS, Park BS, Sung JH, Yang JM, Park SB, Kwak SJ, Park JS. Wound healing effect of adipose-derived stem cells: a critical role of secretory factors on human dermal fibroblasts. J Dermatol Sci. 2007, 48 (1), pp.15-24. 7. Phuc P.V, Nhung T.H, Loan D.T, Chung D.C, Ngoc P.K. Differentiating of banked human umbilical cord blood-derived mesenchymal stem cells into insulin-secreting cells. In Vitro Cell Dev Biol Anim. 2011, 47 (1), pp.54-63. 8. Rittié L, Fisher GJ. UV-light-induced signal cascades and skin aging. Aging Res Rev. 2002, 1 (4), pp.705-720. 9. Song SY, Jung JE, Jeon YR, Tark KC, Lew DH. Determination of adipose-derived stem cell application on photo-aged fibroblasts, based on paracrine function. Cytotherapy. 2011, 13 (3), pp.378-784. 10. Sternlicht MD, Werb Z. How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol. 2001, pp.17463-17516. 7